Neet Biology [2025]
100
Minutes
100
Questions
4 / -1
Marking Scheme
Don't have an account? Sign up for free to save your progress and track your history.
Questions in this Quiz
Q1: Which of the following are required for the dark reaction of photosynthesis? A. Light B. Chlorophyll C. CO₂ D. ATP E. NADPH Choose the correct answers from the options given below:
- A, B and C only
- B, C and D only
- C, D and E only
- D and E only
Q2: Spindle fibers attach to kinetochores of chromosomes during
- Prophase
- Metaphase
- Anaphase
- Telophase
Q3: Buliform cells are responsible for
- Inward curling of leaves in monocots.
- Protecting the plant from salt stress.
- Increased photosynthesis in monocots.
- Providing large spaces for storage of sugars.
Q4: What is the fate of a piece of DNA carrying only gene of interest which is transferred into an alien organism? A. The piece of DNA would be able to multiply itself independently in the progeny cells of the organism. B. It may get integrated into the genome of the recipient. C. It may multiply and be inherited along with the host DNA. D. The alien piece of DNA is not an integral part of chromosome. E. It shows ability to replicate. Choose the correct answer from the options given below:
- A and B only
- D and E only
- B and C only
- A and E only
Q5: Given below are two statements: Statement I : Bit toxins are insect group specific and coded by a gene cry IAc. Statement II : Bit toxin exists as inactive protoxin in B. thuringiensis. However, after ingestion by the insect the inactive protoxin gets converted into active form due to acidic pH of the insect gut. In the light of the above statements, choose the correct answer from the options given below:
- Both Statement I and Statement II are true
- Both Statement I and Statement II are false
- Statement I is true but Statement II is false
- Statement I is false but Statement II is true
Q6: List of endangered species was released by
- GEAC
- WWF
- FOAM
- IUCN
Q7: Identify the part of the seed from the given figure which is destined to form root when the seed germinates.
- A
- B
- C
- D
Q8: Match List I with List II. | List I | List II | | A. Clostridium butylicum | I. Ethanol | | B. Saccharomyces cerevisiae | II. Streptokinase | | C. Trichoderma polysporum | III. Butyric acid | | D. Streptococcus sp. | IV. Cyclosporin-A | Choose the correct answer from the options given below:
- A-III, B-I, C-II, D-IV
- A-II, B-IV, C-III, D-I
- A-III, B-I, C-IV, D-II
- A-IV, B-I, C-III, D-II
Q9: Identify the type of flowers based on the position of calyx, corolla and androectum with respect to the ovary from the given figures (a) and (b).
- (a) Epigynous; (b) Hypogynous
- (a) Hypogynous; (b) Epigynous
- (a) Perigynous; (b) Epigynous
- (a) Perigynous; (b) Perigynous
Q10: Auxin is used by gardeners to prepare weed-free lawns. But no damage is caused to grass as auxin
- promotes apical dominance.
- promotes abscission of mature leaves only.
- does not affect mature monocotyledonous plants.
- can help in cell division in grasses, to produce growth.
Q11: A pink flowered Snapdragon plant was crossed with a red flowered Snapdragon plant. What type of phenotype/s is/are expected in the progeny?
- Only red flowered plants
- Red flowered as well as pink flowered plants
- Only pink flowered plants
- Red, Pink as well as white flowered plants
Q12: Which one of the following is not a criterion for classification of fungi?
- Morphology of mycelium
- Mode of nutrition
- Mode of spore formation
- Fruiting body
Q13: The lactose present in the growth medium of bacteria is transported to the cell by the action of:
- Beta-galactosidase
- Acetylase
- Permease
- Polymerase
Q14: In a plant, black seed color (BB/Bb) is dominant over white seed color (bb). In order to find out the genotype of the black seed plant, with which of the following genotype will you cross it?
- BB
- bb
- Bb
- BB/Bb
Q15: Given below are two statements: Statement I: Parenchyma is living but collenchyma is dead tissue. Statement II: Gymnosperms lack xylem vessels but presence of xylem vessels is the characteristic of angiosperms. In the light of the above statements, choose the correct answer from the options given below:
- Both Statement I and Statement II are true
- Both Statement I and Statement II are false
- Statement I is true but Statement II is false
- Statement I is false but Statement II is true
Q16: How many molecules of ATP and NADPH are required for every molecule of CO₂ fixed in the Calvin cycle?
- 2 molecules of ATP and 3 molecules of NADPH.
- 2 molecules of ATP and 2 molecules of NADPH.
- 3 molecules of ATP and 3 molecules of NADPH.
- 3 molecules of ATP and 2 molecules of NADPH.
Q17: A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;
- Repressor, Operator gene, Structural gene
- Structural gene, Transposons, Operator gene
- Inducer, Repressor, Structural gene
- Promotor, Structural gene, Terminator
Q18: Tropical regions show greatest level of species richness because A. Tropical latitudes have remained relatively undisturbed for millions of years, hence more time was available for species diversification. B. Tropical environments are more seasonal. C. More solar energy is available in tropics. D. Constant environments promote niche specialization. E. Tropical environments are constant and predictable. Choose the correct answer from the options given below:
- A, C, D and E only
- A and B only
- A, B and E only
- A, B and D only
Q19: The equation of Verhulst-Pearl logistic growth is dN/dt = rN[(K-N)/K]. From this equation, K indicates :
- Intrinsic rate of natural increase
- Biotic potential
- Carrying capacity
- Population density
Q20: Inhibition of Succinic dehydrogenase enzyme by malonate is a classical example of :
- Cofactor inhibition
- Feedback inhibition
- Competitive inhibition
- Enzyme activation
Q21: Which one of the following can be explained on the basis of Mendel’s Law of Dominance? A. Out of one pair of factors one is dominant and the other is recessive. B. Alleles do not show any expression and both the characters appear as such in F2 generation. C. Factors occur in pairs in normal diploid plants. D. The discrete unit controlling a particular character is called factor. E. The expression of only one of the parental characters is found in a monohybrid cross. Choose the correct answer from the options given below :
- A, B and C only
- A, C, D and E only
- B, C and D only
- A, B, C, D and E
Q22: Match List I with List II | List I | List II | | A. Nucleolus | I. Site of formation of glycolipid | | B. Centriole | II. Organization like the cartwheel | | C. Leucoplasts | III. Site for active ribosomal RNA synthesis | | D. Golgi apparatus | IV. For storing nutrients | Choose the correct answer from the options given below :
- A-III, B-II, C-IV, D-I
- A-II, B-III, C-I, D-IV
- A-III, B-IV, C-II, D-I
- A-I, B-II, C-III, D-IV
Q23: Identify the set of correct statements: A. The flowers of Vallisneria are colourful and produce nectar. B. The flowers of waterlily are not pollinated by water. C. In most of water-pollinated species, the pollen grains are protected from wetting. D. Pollen grains of some hydrophytes are long and ribbon like. E. In some hydrophytes, the pollen grains are carried passively inside water. Choose the correct answer from the options given below:
- C, D and E only
- A, B, C and D only
- A, C, D and E only
- B, C, D and E only
Q24: Match List-I with List-II | List-I | List-II | | A. Rhizopus | I. Mushroom | | B. Ustilago | II. Smut fungus | | C. Puccinia | III. Bread mould | | D. Agaricus | IV. Rust fungus | Choose the correct answer from the options given below:
- A-III, B-II, C-IV, D-I
- A-I, B-III, C-II, D-IV
- A-III, B-II, C-I, D-IV
- A-IV, B-III, C-II, D-I
Q25: Hind II always cuts DNA molecules at a particular point called recognition sequence and it consists of:
- 8 bp
- 6 bp
- 4 bp
- 10 bp
Q26: Which of the following is an example of actionomorphic flower?
- Datura
- Cassia
- Pisum
- Sesbania
Q27: The type of conservation in which the threatened species are taken out from their natural habitat and placed in special setting where they can be protected and given special care is called:
- in-situ conservation
- Biodiversity conservation
- Semi-conservative method
- Sustainable development
Q28: Given below are two statements: Statement-I: Chromosomes become gradually visible under light microscope during leptotene stage. Statement-II: The begining of diplotene stage is recognized by dissolution of synaptonemal complex. In the light of the above statements, choose the correct answer from the options given below:
- Both Statement-I and Statement-II are true
- Both Statement-I and Statement-II are false
- Statement-I is true but Statement-II is false
- Statement-I is false but Statement-II is true
Q29: Formation of interfascicular cambium from fully developed parenchyma cells is an example for
- Differentiation
- Redifferentiation
- Redifferentiation
- Maturation
Q30: The capacity to generate a whole plant from any cell of the plant is called:
- Totipotency
- Micropropagation
- Differentiation
- Somatic hybridization
Q31: Match List I with List II | List I | List II | | A. Two or more alternative forms of a gene | I. Back cross | | B. Cross of F1 progeny with homozygous recessive parent | II. Ploidy | | C. Cross of F1 progeny with any of the parents | III. Allele | | D. Number of chromosome sets in plant | IV. Test cross | Choose the correct answer from the options given below:
- A-I, B-II, C-III, D-IV
- A-II, B-I, C-III, D-IV
- A-III, B-IV, C-I, D-II
- A-IV, B-III, C-II, D-I
Q32: The cofactor of the enzyme carboxypeptidase is:
- Zinc
- Niacin
- Flavin
- Haem
Q33: These are regarded as major causes of biodiversity loss: A. Over exploitation B. Co-extinction C. Mutation D. Habitat loss and fragmentation E. Migration Choose the correct option:
- A, C and D only
- A, B, C and D only
- A, B and E only
- A, B and D only
Q34: Match List I with List II | List I (Types of Stamens) | List II (Example) | | A. Monoadelphous | I. Citrus | | B. Diadelphous | II. Pea | | C. Polyadelphous | III. Lily | | D. Epiphyllous | IV. China-rose | Choose the correct answer from the options given below:
- A–IV, B–II, C–I, D–III
- A–IV, B–I, C–II, D–III
- A–I, B–II, C–IV, D–III
- A–III, B–I, C–IV, D–II
Q35: Match List I with List II | List I | List II | | A. GLUT-4 | I. Hormone | | B. Insulin | II. Enzyme | | C. Trypsin | III. Intercellular ground substance | | D. Collagen | IV. Enables glucose transport into cells | Choose the correct answer from the options given below:
- A–IV, B–I, C–II, D–III
- A–I, B–II, C–III, D–IV
- A–II, B–III, C–IV, D–I
- A–III, B–IV, C–I, D–II
Q36: Identify the step in tricarboxylic acid cycle, which does not involve oxidation of substrate.
- Malic acid → Oxaloacetic acid
- Succinic acid → Malic acid
- Succinyl-CoA → Succinic acid
- Isocitrate → α-ketoglutaric acid
Q37: Match List I with List II | List I | List II | | A. Citric acid cycle | I. Cytoplasm | | B. Glycolysis | II. Mitochondrial matrix | | C. Electron transport system | III. Intermembrane space of mitochondria | | D. Proton gradient | IV. Inner mitochondrial membrane | Choose the correct answer from the options given below:
- A–I, B–II, C–III, D–IV
- A–II, B–I, C–IV, D–III
- A–III, B–IV, C–I, D–II
- A–IV, B–III, C–II, D–I
Q38: Match List I with List II | List I | List II | | A. Frederick Griffith | I. Genetic code | | B. Francois Jacob & Jacque | II. Semi-conservative mode of DNA replication | | C. Har Gobind Khorana | III. Transformation | | D. Meselson & Stahl | IV. Lac operon | Choose the correct answer from the options given below:
- A–III, B–II, C–I, D–IV
- A–III, B–IV, C–I, D–II
- A–II, B–III, C–IV, D–I
- A–IV, B–I, C–II, D–III
Q39: Given below are two statements : Statement I: In C3 plants, some O2 binds to RuBisCO, hence CO2 fixation is decreased. Statement II: In C4 plants, mesophyll cells show very little photorespiration while bundle sheath cells do not show photorespiration. In the light of the above statements, choose the correct answer from the options given below:
- Both Statement I and Statement II are true
- Both Statement I and Statement II are false
- Statement I is true but Statement II is false
- Statement I is false but Statement II is true
Q40: Identify the correct description about the given figure :
- Wind pollinated plant inflorescence showing flowers with well exposed stamens.
- Water pollinated flowers showing stamens with mucilaginous covering.
- Cleistogamous flowers showing autogamy
- Compact inflorescence showing complete autogamy.
Q41: Match List I with List II | List I | List II | | A. Rose | I. Twisted aestivation | | B. Pea | II. Perigynous flower | | C. Cotton | III. Drupe | | D. Mango | IV. Marginal placentation | Choose the correct answer from the options given below:
- A-II, B-IV, C-I, D-III
- A-I, B-II, C-III, D-IV
- A-IV, B-III, C-II, D-I
- A-II, B-III, C-IV, D-I
Q42: Read the following statements and choose the set of correct statements : In the members of Phaeophyceae, A. Asexual reproduction occurs usually by biflagellate zoospores. B. Sexual reproduction is by oogamous method only. C. Stored food is in the form of carbohydrates which is either mannitol or laminarin. D. The major pigments found are chlorophyll a, c and carotenoids and xanthophyll. E. Vegetative cells have a cellulosic wall, usually covered on the outside by gelatinous coating of algin. Choose the correct answer from the options given below:
- A, B, C and D only
- B, C, D and E only
- A, C, D and E only
- A, B, C and E only
Q43: In an ecosystem if the Net Primary Productivity (NPP) of first trophic level is 100x (kcal m²) yr⁻¹, what would be the GPP (Gross Primary Productivity) of the third trophic level of the same ecosystem ?
- x/10 (kcal m²) yr⁻¹
- x (kcal m²) yr⁻¹
- 10x (kcal m²) yr⁻¹
- 100x/3x (kcal m²) yr⁻¹
Q44: Which of the following statement is correct regarding the process of replication in E.coli?
- The DNA dependent DNA polymerase catalyses polymerization in one direction that is 3' → 5'
- The DNA dependent RNA polymerase catalyses polymerization in one direction, that is 5' → 3'
- The DNA dependent DNA polymerase catalyses polymerization in 5' → 3' as well as 3' → 5' direction
- The DNA dependent DNA polymerase catalyses polymerization in 5' → 3' direction.
Q45: Which of the following are fused in somatic hybridization involving two varieties of plants?
- Callus
- Somatic embryos
- Protoplasts
- Pollens
Q46: Spraying sugarcane crop with which of the following plant growth regulators, increases the length of stem, thus, increasing the yield?
- Auxin
- Gibberellin
- Cytokinin
- Abscisic acid
Q47: Match List I with List II | List I | List II | | A. Robert May | I. Species-Area relationship | | B. Alexander von Humboldt | II. Long term ecosystem experiment using out door plots | | C. Paul Ehrlich | III. Global species diversity at about 7 million | | D. David Tilman | IV. Rivet popper hypothesis | Choose the correct answer from the options given below:
- A-II, B-III, C-I, D-IV
- A-III, B-I, C-IV, D-II
- A-I, B-III, C-II, D-IV
- A-III, B-IV, C-II, D-I
Q48: The DNA present in chloroplast is:
- Linear, double stranded
- Circular, double stranded
- Linear, single stranded
- Circular, single stranded
Q49: Match List I with List II: | List I | List II | | A. Common cold | I. Plasmodium | | B. Haemozoin | II. Typhoid | | C. Widal test | III. Rhinoviruses | | D. Allergy | IV. Dust mites | Choose the correct answer from the options given below:
- A-II, B-IV, C-III, D-I
- A-I, B-III, C-II, D-IV
- A-III, B-I, C-II, D-IV
- A-IV, B-II, C-III, D-I
Q50: Match List I with List II: | List I | List II | | A. Cocaine | I. Effective sedative in surgery | | B. Heroin | II. Cannabis sativa | | C. Morphine | III. Erythroxylum Papaver somniferum | | D. Marijuana | IV. - | Choose the correct answer from the options given below:
- A-IV, B-III, C-I, D-II
- A-I, B-III, C-II, D-IV
- A-II, B-I, C-III, D-IV
- A-III, B-IV, C-I, D-II
Q51: Match List I with List II: | List I | List II | | A. Fibrous joints | I. Adjacent vertebrae, limited movement | | B. Cartilaginous joints | II. Humerus and Pectoral girdle, rotational | | C. Hinge joints | III. Skull, don’t allow any movement | | D. Ball and socket joints | IV. Knee, help in locomotion | Choose the correct answer from the options given below:
- A-IV, B-II, C-III, D-I
- A-I, B-III, C-II, D-IV
- A-II, B-III, C-I, D-IV
- A-III, B-I, C-IV, D-II
Q52: Which of the following are Autoimmune disorders? A. Myasthenia gravis B. Rheumatoid arthritis C. Gout D. Muscular dystrophy E. Systemic Lupus Erythematosus (SLE) Choose the most appropriate answer from the options given below:
- A, B & D only
- A, B & E only
- B, C & E only
- C, D & E only
Q53: Which of the following is not a component of Fallopian tube?
- Uterine fundus
- Isthmus
- Infundibulum
- Ampulla
Q54: The flippers of the Penguins and Dolphins are the example of the
- Adaptive radiation
- Natural selection
- Convergent evolution
- Divergent evolution
Q55: Match List I with List II: | List I | List II | | A. α-1 antitrypsin | I. Cotton bollworm | | B. Cry IAb | II. ADA deficiency | | C. Cry IAc | III. Emphysema | | D. Enzyme replacement therapy | IV. Corn borer | Choose the correct answer from the options given below:
- A-II, B-I, C-IV, D-III
- A-III, B-I, C-II, D-IV
- A-III, B-IV, C-I, D-II
- A-II, B-IV, C-I, D-III
Q56: The following diagram showing restriction sites in E.coli cloning vector pBR322. Find the role of ‘X’ and ‘Y’ genes.
- The gene ‘X’ is responsible for resistance to antibiotics and ‘Y’ for protein involved in the replication of Plasmid.
- The gene ‘X’ is responsible for controlling the copy number of the linked DNA and ‘Y’ for protein involved in the replication of Plasmid.
- The gene ‘X ’ is for protein involved in replication of Plasmid and ‘Y ’ for resistance to antibiotics.
- Gene ‘X’ is responsible for recognition sites and ‘Y’ is responsible for antibiotic resistance.
Q57: Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R: Assertion A: Breast-feeding during initial period of infant growth is recommended by doctors for bringing a healthy baby. Reason R: Colostrum contains several antibodies absolutely essential to develop resistance for the new born baby. In the light of the above statements, choose the most appropriate answer from the options given below:
- Both A and R are correct and R is the correct explanation of A.
- Both A and R are correct but R is NOT the correct explanation of A.
- A is correct but R is not correct.
- A is not correct but R is correct.
Q58: The "Ti plasmid" of Agrobacterium tumefaciens stands for
- Tumour inhibiting plasmid
- Tumor independent plasmid
- Tumor inducing plasmid
- Temperature independent plasmid
Q59: Match List I with List II : | List I | List II | | A. Pleurobrachia | I. Mollusca | | B. Radula | II. Ctenophora | | C. Stomochord | III. Osteichthyes | | D. Air bladder | IV. Hemichordata | Choose the correct answer from the options given below :
- A-IV, B-II, C-III, D-I
- A-II, B-I, C-IV, D-III
- A-II, B-IV, C-I, D-III
- A-IV, B-III, C-II, D-I
Q60: Given below are some stages of human evolution. Arrange them in correct sequence (Past to Recent) A. Homo habilis B. Homo sapiens C. Homo neanderthalensis D. Homo erectus Choose the correct sequence of human evolution from the options given below :
- D-A-C-B
- B-A-D-C
- C-B-D-A
- A-D-C-B
Q61: The following are the statements about non-chordates: A. Pharynx is perforated by gill slits. B. Notochord is absent. C. Central nervous system is dorsal. D. Heart is dorsal if present. E. Post anal tail is absent.
- A & C only
- A, B & D only
- B, D & E only
- B, C & D only
Q62: In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on :
- 5th segment
- 10th segment
- 8th and 9th segment
- 11th segment
Q63: Which one of the following factors will not affect the Hardy-Weinberg equilibrium ?
- Genetic recombination
- Genetic drift
- Gene migration
- Constant gene pool
Q64: Match List I with List II : | List I | List II | | A. Pons | I. Provides additional space for Neurons, regulates posture and balance. | | B. Hypothalamus | II. Controls respiration and gastric secretions | | C. Medulla | III. Connects different regions of the brain | | D. Cerebellum | IV. Neuro secretory cells | Choose the correct answer from the options given below :
- A-II, B-III, C-I, D-IV
- A-III, B-IV, C-II, D-I
- A-I, B-III, C-II, D-IV
- A-II, B-I, C-III, D-IV
Q65: Match List I with List II : | List I | List II | | A. Down's syndrome | I. 11th chromosome | | B. α-Thalassemia | II. X chromosome | | C. β-Thalassemia | III. 21st chromosome | | D. Klinefelter's syndrome | IV. 16th chromosome | Choose the correct answer from the options given below :
- A-I, B-II, C-III, D-IV
- A-II, B-III, C-IV, D-I
- A-III, B-IV, C-I, D-II
- A-IV, B-I, C-II, D-III
Q66: Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'
- 5'AUGUACCGUUUAAGGUAAAGU3'
- 5'AUGUAAAGUUUAAGGUAAAGU3'
- 5'AUGUACCGUUUAAGGGAAAGU3'
- 5'ATGTACCGTTTATAGGTAGGT3'
Q67: Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R. Assertion A: FSH acts upon ovarian follicles in female and Leydig cells in male. Reason R: Growing ovarian follicles secrete estrogen in female while interstitial cells secrete androgen in male human being. In the light of the above statements, choose the correct answer from the options given below :
- Both A and R are true and R is the correct explanation of A.
- Both A and R are true but R is NOT the correct explanation of A.
- A is true but R is false.
- A is false but R is true.
Q68: Which of the following is not a natural/traditional contraceptive method ?
- Coitus interruptus
- Periodic abstinence
- Lactational amenorrhea
- Vaults
Q69: Match List-I with List-II : | List-I | List-II | | A. Non-medicated IUD | I. Multiload 375 | | B. Copper releasing IUD | II. Progestogens | | C. Hormone releasing IUD | III. Lippes loop | | D. Implants | IV. LNG-20 | Choose the correct answer from the options given below :
- A-III, B-I, C-II, D-IV
- A-I, B-III, C-IV, D-II
- A-IV, B-I, C-II, D-III
- A-III, B-I, C-IV, D-II
Q70: Consider the following statements : A. Annelids are true coelomates B. Poriferans are pseudocoelomates C. Aschelminthes are acoelomates D. Platyhelminthes are pseudocoelomates Choose the correct answer from the options given below :
- B only
- A only
- C only
- D only
Q71: Three types of muscles are given as a, b and c. Identify the correct matching pair along with their location in human body :
- (a) Smooth-Toes (b) Skeletal - Legs (c) Cardiac - Heart
- (a) Skeletal - Triceps (b) Smooth - Stomach (c) Cardiac - Heart
- (a) Skeletal - Biceps (b) Involuntary - Intestine (c) Smooth - Heart
- (a) Involuntary - Nose tip (b) Skeletal - Bone (c) Cardiac - Heart
Q72: Following are the stages of pathway for conduction of an action potential through the heart : A. AV bundle B. Purkinje fibres C. AV node D. Bundle branches E. SA node Choose the correct sequence of pathway from the options given below :
- E-C-A-D-B
- A-E-C-B-D
- B-D-E-C-A
- E-A-D-B-C
Q73: Match List I with ListII : | List-I | List-II | | A. Lipase | I. Peptide bond | | B. Nuclease | II. Ester bond | | C. Protease | III. Glycosidic bond | | D. Amylase | IV. Phosphodiester bond | Choose the correct answer from the options given below :
- A-IV, B-II, C-III, D-I
- A-III, B-II, C-I, D-IV
- A-II, B-IV, C-I, D-III
- A-IV, B-I, C-III, D-II
Q74: Match List I with ListII : | List-I | List-II | | A. Axoneme | I. Centriole | | B. Cartwheel pattern | II. Cilia and flagella | | C. Crista | III. Chromosome | | D. Statellite | IV. Mitochondria | Choose the correct answer from the options given below :
- A-IV, B-III, C-II, D-I
- A-IV, B-II, C-III, D-I
- A-II, B-IV, C-I, D-III
- A-II, B-I, C-IV, D-III
Q75: Match List I with ListII : | List-I (Sub Phases of Prophese I) | List-II (Specific characters) | | A. Diakinesis | I. Synaptonemal complex formation | | B. Pachytene | II. Completion of terminalisation of chiasmata | | C. Zygotene | III. Chromosomes look like thin threads | | D. Leptotene | IV. Appearance of recombination nodules | Choose the correct answer from the options given below :
- A-IV, B-II, C-III, D-I
- A-I, B-II, C-IV, D-III
- A-II, B-IV, C-I, D-III
- A-IV, B-III, C-II, D-I
Q76: Which of the following factors are favourable for the formation of oxyhaemoglobin in alveoli?
- High pO₂ and High pCO₂
- High pO₂ and Lesser H⁺ concentration
- Low pCO₂ and High H⁺ concentration
- Low pCO₂ and High temperature
Q77: Match List I with List II: A. Axoneme B. Cartwheel pattern C. Crista D. Statellite I. Centriole II. Cilia and flagella III. Chromosome IV. Mitochondria Choose the correct answer from the options given below:
- A-IV, B-III, C-II, D-I
- A-IV, B-II, C-III, D-I
- A-II, B-IV, C-I, D-III
- A-II, B-I, C-IV, D-III
Q78: Match List I with List II: (Sub Phases of Prophase I) A. Diakinesis B. Pachytene C. Zygotene D. Leptotene (Specific characters) I. Synaptonemal complex formation II. Completion of terminalisation of chiasmata III. Chromosomes look like thin threads IV. Appearance of recombination nodules Choose the correct answer from the options given below:
- A-IV, B-II, C-III, D-I
- A-I, B-II, C-IV, D-III
- A-II, B-IV, C-I, D-III
- A-IV, B-III, C-II, D-I
Q79: Which of the following factors are favourable for the formation of oxyhaemoglobin in alveoli?
- High pO₂ and High pCO₂
- High pO₂ and Lesser H⁺ concentration
- Low pCO₂ and High H⁺ concentration
- Low pCO₂ and High temperature
Q80: Match List I with List II: A. Pierophyllum B. Myxine C. Pristis D. Exocoetus I. Hag fish II. Saw fish III. Angel fish IV. Flying fish Choose the correct answer from the options given below:
- A-II, B-I, C-III, D-IV
- A-III, B-I, C-II, D-IV
- A-IV, B-I, C-II, D-III
- A-III, B-II, C-I, D-IV
Q81: Match List I with List II: A. Typhoid B. Leishmaniasis C. Ringworm D. Filariasis I. Fungus II. Nematode III. Protozoa IV. Bacteria Choose the correct answer from the options given below:
- A-I, B-III, C-II, D-IV
- A-IV, B-III, C-I, D-II
- A-III, B-I, C-IV, D-II
- A-II, B-IV, C-III, D-I
Q82: Which of the following statements is incorrect?
- A bio-reactor provides optimal growth conditions for achieving the desired product.
- Most commonly used bio-reactors are of stirring type.
- Bio-reactors are used to produce small scale bacterial cultures.
- Bio-reactors have an agitator system, an oxygen delivery system and foam control system.
Q83: Given below are two statements: Statement I: In the nephron, the descending limb of loop of Henle is impermeable to water and permeable to electrolytes. Statement II: The proximal convoluted tubule is lined by simple columnar brush border epithelium and increases the surface area for reabsorption. In the light of the above statements, choose the correct answer from the options given below:
- Both Statement I and Statement II are true.
- Both Statement I and Statement II are false.
- Statement I is true but Statement II is false.
- Statement I is false but Statement II is true.
Q84: Given below are two statements: Statement I: The presence or absence of hymen is not a reliable indicator of virginity. Statement II: The hymen is torn during the first coitus only. In the light of the above statements, choose the correct answer from the options given below:
- Both Statement I and Statement II are true
- Both Statement I and Statement II are false.
- Statement I is true but Statement II is false.
- Statement I is false but Statement II is true.
Q85: Match List I with List II: A. Expiratory capacity B. Functional residual capacity C. Vital capacity D. Inspiratory capacity I. Expiratory reserve volume + Tidal Volume + Inspiratory reserve volume II. Tidal volume + Expiratory reserve volume III. Tidal volume + Inspiratory reserve volume IV. Expiratory reserve volume + Residual volume Choose the correct answer from the options given below:
- A-II, B-IV, C-I, D-III
- A-III, B-II, C-IV, D-I
- A-II, B-I, C-IV, D-III
- A-I, B-III, C-II, D-IV
Q86: Following are the stages of cell division: A. Gap 2 phase B. Cytokinesis C. Synthesis phase D. Karyokinesis E. Gap 1 phase Choose the correct sequence of stages from the options given below:
- C-E-D-A-B
- E-B-D-A-C
- B-D-E-A-C
- E-C-A-D-B
Q87: Given below are two statements: Statement I: Mitochondria and chloroplasts are both double membrane bound organelles. Statement II: Inner membrane of mitochondria is relatively less permeable, as compared to chloroplast. In the light of the above statement, choose the most appropriate answer from the options given below:
- Both Statement I and Statement II are correct
- Both Statement I and Statement II are incorrect.
- Statement I is correct but Statement II is incorrect.
- Statement I is incorrect but Statement II is correct
Q88: Match List I with List II: A. Mesozoic Era B. Proterozoic Era C. Cenozoic Era D. Paleozoic Era I. Lower invertebrates II. Fish & Amphibia III. Birds & Reptiles IV Mammals Choose the correct answer from the options given below:
- A-II, B-I, C-III, D-IV
- A-III, B-I, C-II, D-IV
- A-I, B-II, C-IV, D-III
- A-III, B-I, C-IV, D-II
Q89: Given below are two statements: Statement I: Gauss's competitive exclusion principle states that two closely related species competing for different resources cannot exist indefinitely. Statement II: According to Gauss's principle, during competition, the inferior will be eliminated. This may be true if resources are limiting. In the light of the above statements, choose the correct answer from the options given below:
- Both Statement I and Statement II are true
- Both Statement I and Statement II are false.
- Statement I is true but Statement II is false.
- Statement I is false but Statement II is true.
Q90: Match List I with List II: A. Unicellular glandular epithelium B. Compound epithelium C. Multicellular glandular epithelium D. Endocrine glandular epithelium I. Salivary glands II. Pancreas III. Goblet cells of alimentary canal IV. Moist surface of buccal cavity Choose the correct answer from the options given below:
- A-II, B-I, C-III, D-IV
- A-IV, B-III, C-I, D-II
- A-III, B-IV, C-I, D-II
- A-II, B-I, C-IV, D-III
Q91: Match List I with List II related to digestive system of cockroach: A. The structures used for storing of food. B. Ring of 6-8 blind tubules at junction of foregut and midgut. C. Ring of 100-150 yellow coloured thin filaments at junction of midgut and hindgut. D. The structures used for grinding the food. I. Gizzard II. Gastric Caeca III. Malpighian tubules IV. Crop Choose the correct answer from the options given below:
- A-IV, B-II, C-III, D-I
- A-I, B-II, C-III, D-IV
- A-IV, B-III, C-II, D-I
- A-III, B-II, C-IV, D-I
Q92: Choose the correct statement given below regarding juxta medullary nephron:
- Juxta medullary nephrons are located in the colourms of Bertini.
- Renal corpuscle of juxta medullary nephron lies in the outer portion of the renal medulla.
- Loop of Henle of juxta medullary nephron runs deep into medulla.
- Juxta medullary nephrons outnumber the cortical nephrons.
Q93: Match List I with List II: A. RNA polymerase III B. Termination of transcription C. Splicing of Exons D. TATA box I. snRNPs II. Promotor III. Rho factor IV. SnRNAs, tRNA Choose the correct answer from the options given below:
- A-II, B-IV, C-I, D-III
- A-III, B-II, C-IV, D-I
- A-III, B-IV, C-I, D-II
- A-IV, B-III, C-I, D-II
Q94: Given below are two statements: Statement I: The cerebral hemispheres are connected by nerve tract known as corpus callosum. Statement II: The brain stem consists of the medulla oblongata, pons and cerebrum. In the light of the above statements, choose the most appropriate answer from the options given below:
- Both Statement I and Statement II are correct.
- Both Statement I and Statement II are incorrect.
- Statement I is correct but Statement II is incorrect.
- Statement I is incorrect but Statement II is correct.
Q95: Identify the correct option (A), (B), (C), (D) with respect to spermatogenesis:
- FSH, Leydig cells, Sertoli cells, spermiogenesis
- ICSH, Interstitial cells, Leydig cells, spermiogenesis.
- FSH, Sertoli cells, Leydig cells, spermatogenesis.
- ICSH, Leydig cells, Sertoli cells, spermatogenesis.
Q96: As per ABO blood grouping system, the blood group of father is B*, mother is A* and child is O*. Their respective genotype can be: A. IᴮI, IᴬI, ii B. Iᴮi, Iᴬi, ii C. IᴮI, Iᴬi, IᴬI D. Iᴮi, IᴬI, Iᴬi E. IᴮI, IᴬI, IᴬI Choose the most appropriate answer from the options given below:
- A only
- B only
- C & B only
- D & E only
Q97: Given below are two statements: Statement I: Bone marrow is the main lymphoid organ where all blood cells including lymphocytes are produced. Statement II: Both bone marrow and thymus provide micro environments for the development and maturation of T-Lymphocytes. In the light of the above statements, choose the most appropriate answer from the options given below:
- Both Statement I and Statement II are correct.
- Both Statement I and Statement II are incorrect.
- Statement I is correct but Statement II is incorrect.
- Statement I is incorrect but Statement II is correct.
Q98: Regarding catalytic cycle of an enzyme action, select the correct sequential steps: A. Substrate enzyme complex formation. B. Free enzyme ready to bind with another substrate. C. Release of products. D. Chemical bonds of the substrate broken. E. Substrate binding to active site. Choose the correct answer from the options given below:
- E, A, D, C, B
- A, E, B, D, C
- B, A, C, D, E
- E, D, C, B, A
Q99: Match List I with List II: A. P wave B. QRS complex C. T wave D. T-P gap I. Heart muscles are electrically silent. II. Depolarisation of ventricles. III. Depolarisation of atria. IV. Repolarisation of ventricles. Choose the correct answer from the options given below:
- A-I, B-III, C-IV, D-II
- A-III, B-II, C-IV, D-I
- A-II, B-III, C-I, D-IV
- A-IV, B-II, C-I, D-III
Q100: Match List I with List II: A. Exophthalmic goiter B. Acromegaly C. Cushing's syndrome D. Cretinism I. Excess secretion of cortisol, moon face & hyperglycemia. II. Hypo-secretion of thyroid hormone and stunted growth. III. Hyper secretion of thyroid hormone & protruding eye balls. IV. Excessive secretion of growth hormone. Choose the correct answer from the options given below:
- A-I, B-III, C-II, D-IV
- A-IV, B-II, C-I, D-III
- A-III, B-IV, C-II, D-I
- A-III, B-IV, C-I, D-II